Journal of Advanced Veterinary Research Volume 9, Issue 1, 2019, Pages 1-7

Incidence of Salmonella species in Table Eggs and some Egg-based Products

Enas El-Prince¹, Mahmoud F. Hussein², Amira M. Abd El-Rahman²

¹Department of Food Hygiene, Faculty of Veterinary Medicine, Assiut University, Egypt

²Animal Health Research Institute, Assiut, Egypt

Received 9 October 2018, Accepted 1 January 2019

Abstract

The incidence of Salmonella species was determined in 1050 eggs including balady hen’s eggs, farm hen's eggs and duck's eggs (350 eggs each represented by 70 samples as every 5 eggs constitute one sample) and in 90 samples of egg-based products including mayonnaise, cream cake and custard (30 each) were collected from different localities in Assiut city, Egypt. Salmonella was recovered from 8.58, 5.72% of balady hen's egg shells using Xylose Lysine Deoxycholate (XLD) agar and Salmonella Shigella (SS) agar, respectively and could be isolated from egg content in a percentage of 1.43% by XLD agar. Different serotypes of Salmonella were isolated from shells of balady hen’s eggs including S. typhimurium, S. anatum, S. infantis, S. kentucky while, S. enteritidis was the only serotype that recovered from both shell and content. In case of farm hen’s eggs, S. kentucky and S. infantis could be identified from positive shell and content samples, respectively at same percentage of 1.43% by using XLD agar. On the other hand, Salmonella could not be detected on SS agar from both shell and content of all examined samples. Concerning duck’s eggs 4.29 and 1.43% of shell samples were contaminated with Salmonella by using XLD and SS, respectively. While, 2.86 and 1.43% of examined egg content samples were positive using XLD and SS agar, respectively and S. typhimurium was the predominant serotype which isolated from both shell and content samples. While, S. infantis was recovered from shell only and S. kentucky was isolated from content only. Salmonella species were existed in 2 (6.66%) and 1 sample (3.33%) of the examined cream cake using XLD and SS agar, respectively while, none of the examined custard and mayonnaise samples were positive for Salmonella on both media. S. kentucky, S. shubra and S. enteritidis were isolated from the positive cream cake samples with an equal incidence of 3.33 % for each. Although XLD agar was found to be comparatively better in recovering Salmonella species than SS agar, the two media were found to be complementary to each other for recovering different Salmonella serotypes. Detection of common invA gene in all isolated Salmonella serotypes by PCR assay showed positive amplification of 284 bp fragment specific for the invA gene with total percentage of 100%. Screening of 12 isolates of S. typhimurium and S. enteritidis, which were the most prevalent serotypes in the positive samples for stn, hilA and fimH virulence genes by multiplex PCR revealed varying distribution pattern. The public health hazards and the recommended measures required to prevent contamination of eggs and its based products by Salmonella were discussed.

Keywords:

Salmonella, Table eggs, Mayonnaise, Cream cake, Custard

Introduction

For thousands of years, eggs and its products have represented an important part of human diet as they are easy to obtain and they are rich in nutrients, containing proteins, minerals, fats, vitamins and more. While eggs are highly nutritious for humans, they are also nutritious for other living organisms. Just as the yolk provides nutrients to a growing embryo, it is also a nutritional resource for bacterial organisms when they cross egg shells and membranes. Scientific Committee on Veterinary Measures relating to public health has identified eggs and egg-based products containing raw eggs as a food group, which pose a public health hazard (European Commission, 2003). Eggs and egg-based products that are improperly handled can be a source of foodborne microorganisms, such as Salmonella, which is one of the most prevalent causes of foodborne illness (Howard et al., 2012; Galis et al., 2013). It has been the second after Campylobacter most commonly recorded cause of zoonotic disease in Europe. In 2012, a total of 91,034 confirmed cases of human salmonellosis were reported in the European Union, the EU notification rate for confirmed cases was 22.2 per 100,000 populations and the case-fatality rate was 0.14% as 61 deaths due to non-typhoidal salmonellosis (European Food Safety Authority, 2014). The genus Salmonella comprises two species, the first one is S. enterica, which is divided into six subspecies. The second species named S. bongori (formerly called S. enterica subspecies bongori V). Species and subspecies can be distinguished on the basis of characters and antigenic formulae into 2501 serovars (Solari et al., 2003). However, a recent report from the Centre for Infectious Disease Research and Policy classifies members of the Salmonella species into more than 2541 serotypes (serovars) according to their somatic (O) and flagellar (H) antigens (CIDRAP, 2006). People generally acquire salmonellosis through foodborne exposure and direct contact with infected animals. A variety of investigations of outbreaks and sporadic cases have indicated that the most common food vehicles of Salmonella infections in humans are poultry and poultry products, including raw and uncooked eggs (Hennessy et al., 2004; Plym and Wierup, 2006). In the United States between 1985 and 2002 contamination of eggs was identified as the source of 53% of all cases of Salmonella reported to the Centre for Disease Control and Prevention (Food Drug Administration, 2009). The two most commonly identified causative agents of foodborne salmonellosis are S. enterica serotypes typhimurium and enteritidis (Galis et al., 2013).

There are two pathways for eggs to become internally contaminated with Salmonella, direct contamination during egg formation in hen’s ovary and oviduct (vertical transmission). Whereas, indirect contamination occurs after egg has been laid and Salmonella contaminating egg from colonized gut or from contaminated feces penetrates through the shell membrane (horizontal transmission) to egg. Such route is facilitated by moist egg shells, storage at ambient temperature and shell damage (De Reu et al., 2006; Howard et al., 2012). Both S. enteritidis and S. typhimurium have been demonstrated to have the ability to colonize the reproductive tract of hens (Gantois et al., 2008), however, S. enteritidis is more frequently isolated from the internal contents of eggs due to its ability to adhere better to reproductive tract mucosa compared to S. typhimurium (Wales and Davies, 2011). Although various bacterial pathogens have contaminated chicken's eggs, Salmonella accounts for the majority of documented cases (Spitzer, 2016). Certain food items have been specifically associated with cases of human salmonellosis and these include homemade desserts, ice cream and drinks containing raw eggs, shop-bought sandwiches containing mayonnaise or eggs, lightly cooked eggs and fried eggs “sunny-side up” (Molbak and Niemann, 2002). So that, Salmonella was isolated from eggs and egg-based products in different countries including Mexico, England, Yemen, Egypt, Japan, Turkey, Korea and Ethiopia by several investigators (Martinez et al., 2005; Little et al., 2007; Taha et al., 2010; Abd El Tawwab et al., 2013; Murakami et al., 2013; Can et al., 2014; Min Chan et al., 2015; Tsegaye et al., 2016). Considering the facts that emergence of egg associated salmonellosis as a leading foodborne disease, pandemic nature of Salmonella and globalized nature of trade and commerce, it is assumed important to study the incidence of Salmonella in various types of consumed eggs and its based products in Assiut governorate and to determine the risk associated with this commodity.

Materials and methods

Collection of samples

A total of 1050 eggs including balady hen’s eggs, farm hen’s eggs and duck’s eggs (350 eggs each represented by 70 samples as every 5 eggs constitute one sample). Also, 90 samples of egg-based products including mayonnaise, cream cake and custard (30 samples each) were collected from different localities in Assiut city, Egypt.

Preparation of samples

Egg samples

Egg shells were tested as described by Moats (1980) and contents were prepared and evacuated according to Speck (1984).

Egg-based product samples

Samples were released aseptically from their containers and were prepared according to APHA (1992).

Isolation of Salmonella species

Salmonella species were isolated and identified biochemically according to Andrews and Hammack (2001) and ISO-6579 (2002).

Serological identification of Salmonella

According to Kauffman-White scheme (Kauffmann, 1974) for the determination of somatic (O) and flagellar (H) antigens using Salmonella antiserum (DENKA SEIKEN Co., Japan).

Polymerase Chain Reaction (PCR)

PCR was applied for detection of invasion A (invA) gene in all isolated Salmonella species and for identification of virulence factors including, enterotoxin (stn), hyper-invasive locus (hilA) and fimbrial (fimH) genes in both S. typhimurium and S. enteritidis by using primers (Pharmacia Biotech) as shown in Table 1.

Table 1.  List of primers used for PCR amplification

Target gene	Oligonucleotide sequence (5′ → 3′)	Product size (bp)	References
InvA (F)	5′ GTGAAATTATCGCCACGTTCGGGCA ′3	284	Shanmugasamy et al. (2011)
invA (R)	5′ TCATCGCACCGTCAAAGGAACC ′3
Stn (F)	5′ CTTTGGTCGTAAAATAAGGCG ′3	260	Makino et al. (1999)
Stn (R)	5′ TGCCCAAAGCAGAGAGATTC ′3
HilA (F)	5′ CTGCCGCAGTGTTAAGGATA ′3	497	Guo et al. (2000)
HilA (R)	5′ CTGTCGCCTTAATCGCATGT ′3
FimH (F)	5′ GGA TCC ATG AAA ATA TAC TC ′3	1008	Menghistu et al. (2011)
FimH (R)	5′ AAG CTT TTA ATC ATA ATC GAC TC ′3

Results and Discussion

The present study showed that Salmonella was recovered from 8.58, 5.72% of balady hen’s egg shells using Xylose Lysine Deoxycholate agar (XLD) and Salmonella Shigella (SS) agar, respectively (Table 2).

Shell surfaces can be contaminated congenitally from carrier hens, which disseminate the organisms to widely distributed areas that receive the infected eggs. Also shells can be contaminated by excreta of farm animals live with balady chicken in the same place as a bad habit of Egyptian farmers, where Dhillon et al. (1974) showed that contaminated water, environment and intestinal tract are the main sources of shell contamination.

The egg shell incidence using XLD agar was in agreement with that indicated by Hussien et al. (2009) as 9% and by Rashwan (2013) as 7.83%. While, it was lower than that observed by Adil et al. (2012) (34.12%) and El Sherif and Hassan (2013) (26.67%). However, El-Prince (1988); Korashy et al. (2008) and El-Kholy et al. (2014) failed to detect Salmonella in all of examined egg shell samples. Moreover, Salmonella could be detected in balady hen’s egg content in a percentage of 1.43% by using XLD agar only. Nearly similar result was recorded by El Jakee et al. (2016) (1.3%). While, highest percentages were obtained by Osman et al. (2011); Adil et al. (2012) and El Sherif and Hassan (2013). In the contrary, Salmonella species could not be isolated from balady hen’s egg content by Msallam (2008) and Arif (2013). This variability may be referred to the health status of hens as transovarian transmission of Salmonella to eggs and the extent of shell contamination and the subsequent penetration of the shell (De Buck et al., 2004).

Table 2. Incidence of Salmonella species in the examined egg and egg-based products sample

Samples		No. of examined samples	Positive samples
			XLD		SS
			No.	%	No.	%
Balady hen^’s egg	Shell	70	6	8.58	4	5.72
	Content	70	1	1.43	-	-
Farm hen^’s egg	Shell	70	1	1.43	-	-
	Content	70	1	1.43	-	-
Duck^’s egg	Shell	70	3	4.29	1	1.43
	Content	70	2	2.86	1	1.43
	Mayonnaise	30	-	-	-	-
	Cream cake	30	2	6.66	1	3.33
	Custard	30	-	-	-	-
Total		510	16	3.14	7	1.37

Different serotypes of Salmonella were isolated from balady hen’s egg shells including S. typhimurium, S. anatum and S. kentucky each of 1.43% using both agars. While, S. infantis could be recovered from 1.43% of balady hen’s egg shell samples using XLD agar (Table 3). Moreover, S. enteritidis was recovered from balady hen’s egg shells in percentages of 2.86 and 1.43% by using XLD and SS agar, respectively and was isolated from egg contents in a percentage of 1.43% by using XLD agar. S. enteritidis is known to have unusual ability to colonize in ovarian tissues of hens and transmitted vertically to be presents within the contents of intact shell eggs, therefore it is not surprising that it was isolated from shells and contents (Olsen and Hammack, 2000). Moreover, Shirota et al. (2001) suggested that S. enteritidis was more associated with human foodborne disease outbreaks than other Salmonella serotypes particularly those associated with egg and egg products which results in more deaths than any other pathogen. Lower S. enteritidis incidence (0.6%) from egg content was detected by El Jakee et al. (2016), however, Osman et al. (2011) showed higher value.

In the case of farm hen’s eggs, the incidence of Salmonella in shell samples was 1.43% (by using XLD agar only) (Table 2). This indicates that eggs were contaminated either during its lays through the contaminated cloacae or from direct contact with contaminated nest, litter, trays and transport boxes after collection and delivered to markets.

This result agreed to some extent with those of Musgrove et al. (2005) (1.19%) and Wilson (2007) (1.8%), while, Murchie et al. (2007) demonstrated lower incidence of shell contamination in island of Ireland (0.04%). However, the value of Salmonella in farm hen’s egg shell is lower than that of Almario (2014) (10.7%); Min Chan et al. (2015) (17%); and Zubair et al. (2017) (4.85%). On the other hand, Favier et al. (2001) failed to isolate Salmonella from 122 egg shell samples.

In addition, one sample (1.43%) out of 70 examined egg content samples was contaminated with Salmonella by using XLD agar. Low incidence of content contamination may be attributed to the antimicrobial effect of egg albumen and also may be due to low contamination rate (Thammasuvimol et al., 2006; Van Immerseel, 2010). Also, Salmonella could not be isolated on SS agar from both shell and content of all examined farm hen’s egg samples. However, S. kentucky (one strain from shell) and S. infantis (one strain from content) were identified (1.43% for each) as shown in Table 3.

Table 3. Incidence of different Salmonella serotypes in the examined egg and egg- based products sample

Samples	Used media	Salmonella serotypes
		S. typhimurium		S. enteritidis		S. anatum		S. infantis		S. kentucky		S. shubra
		No.	%	No.	%	No.	%	No.	%	No.	%	No.	%
Balady hen^’s egg shell	XLD	1	1.43	2	2.86	1	1.43	1	1.43	1	1.43	-	-
	SS	1	1.43	1	1.43	1	1.43	-	-	1	1.43	-	-
Balady hen^’s egg content	XLD	-	-	1	1.43	-	-	-	-	-	-	-	-
	SS	-	-	-	-	-	-	-	-	-	-	-	-
Farm hen^’s egg shell	XLD	-	-	-	-	-	-	-	-	1	1.43	-	-
	SS	-	-	-	-	-	-	-	-	-	-	-	-
Farm hen^’s egg content	XLD	-	-	-	-	-	-	1	1.43	-	-	-	-
	SS	-	-	-	-	-	-	-	-	-	-	-	-
Duck^’s egg shell	XLD	3	4.29	-	-	-	-	-	-	-	-	-	-
	SS	-	-	-	-	-	-	1	1.43	-	-	-	-
Duck^’s egg content	XLD	1	1.43	-	-	-	-	-	-	1	1.43	-	-
	SS	1	1.43	-	-	-	-	-	-	-	-	-	-
Cream cake	XLD	-	-	-	-	-	-	-	-	1	3.33	1	3.33
	SS	-	-	1	3.33	-	-	-	-	-	-	-	-

XLD: Xylose Lysine Deoxycholate agar

SS: Salmonella Shigella agar

Although, there are relatively low incidence of positive samples in farm hen’s eggs the pathogens represent a potential risk to consumers on the basis that all Salmonella are potentially pathogenic (Zansky et al., 2002; Kabir, 2009).

The incidence of Salmonella in examined duck’s egg shell samples was 4.29% on XLD agar and 1.43% on SS agar (Table 2). Nearly similar result was obtained by Harsha et al. (2011), while, higher values were conducted by Korashy et al. (2008) and Suksangawong (2008), however, Rezk and Saleh (2008); Adzitey et al. (2012); Nor Faiza et al. (2013) and Sedeek and Aioub (2014) could not detect Salmonella in all of examined duck’s egg shell samples. In case of duck’s egg contents, 2.86 and 1.43% of samples were contaminated with Salmonella by using XLD and SS agar, respectively. Bad habits of ducks as laying eggs near dirty and damp places, in addition to rapid deterioration of the antibacterial activity of albumen on storage give the chance to raise the rate of contamination in duck’s eggs. There is also a practice of eating raw eggs among the villagers as they consider it more nutritious. Hence the prevalence of Salmo¬nella in duck’s eggs poses definite threat to unwary consumers.

Concerning Salmonella serotypes it is noticeable that, the predominant serotype in duck’s eggs was S. typhimurium which isolated from 3 shell samples (4.29%) on XLD agar and isolated from content with equal incidence of 1.43% by using each of both media. Also, one isolate of S. infantis was recovered from egg shell on SS agar, while, S. kentucky was isolated from one egg content sample by using XLD agar (Table 3).

Regarding to egg-based products, none of examined custard and mayonnaise samples were positive for Salmonella on both media. While, Salmonella species were existed in 2 (6.66%) and 1 sample (3.33%) of the examined cream cake using XLD and SS agar, respectively. S. kentucky and S. shubra were isolated from the positive cream cake samples with an incidence of 3.33% for each using XLD agar. While, by using SS agar S. enteritidis could be isolated in percentage of 3.33% (Tables 2 and 3). Unlike this study, Gumus et al. (2005); Meldrum et al. (2006) and Siriken et al. (2009) did not find Salmonella in any of cream cake samples. While, higher percentage (16%) was indicated by Can et al. (2014) in cream cake samples produced in Turkey.

In the present study, XLD agar was found to be comparatively better in recovering Salmonella than SS agar as Salmonella species were isolated from 16 (3.14%) out of 510 egg and egg-based product samples using XLD agar. While, by using SS agar they were isolated from 7 (1.37%) (Table 2). This result is in harmony with that postulated by Rall et al. (2005); Rashwan (2013) and Taha et al. (2013).

In this study PCR assay was carried out for detection of invA gene (common gene) in all of the 23 isolated Salmonella strains. All isolates showed positive amplification of 284 bp fragment specific for the invA gene with total percentage of 100% as shown in Table 4 and Fig. 1. Therefore, PCR method based on invA gene is a rapid and reliable method for detection and confirmation of Salmonella as a complementary to conventional culture methods (Rodulfo et al., 2012). This result is in conformity to previous studies observed by Karmi (2013); Ezzat et al. (2014) and Osman et al. (2014).

Table 4. Results of PCR of the isolated Salmonella species from the examined egg and egg-based products samples.

The isolated strain	No. of isolates	Positive isolates for invA gene
S. typhimurium	7	7
S. enteritidis	5	5
S. anatum	2	2
S. infantis	3	3
S. kentucky	5	5
S. shubra	1	1
Total	23	23

To assess the virulence of Salmonella isolated from the examined egg and egg-based product samples, the distribution of 3 virulence genes namely stn, hilA and fimH genes was determined in the isolates of S. typhimurium and S. enteritidis because of their higher prevalence in the examined samples and also they are the most commonly isolated Salmonella from foodborne outbreaks. For this purpose, multiplex polymerase chain reaction (MPCR) technique was used which uses pairs of primers that allow the simultaneous detection and identification of different specific DNA sequences in the same sample at the same time (Maciorowski et al., 2005).

Fig. 1. Agarose gel electrophoresis of PCR of invA (284 bp) gene for demonstration of Salmonella species isolated from the examined samples of eggs and egg-based products.

Lane M: 100 bp ladder as molecular size DNA marker. Lane 1: Control positive Salmonella strain for invA gene. Lane 2: Control negative. Lanes from 3 to 25: The 23 positive Salmonella strains for invA gene.

Varying distribution pattern of these virulence genes was observed among S. typhimurium and S. enteritidis isolates. Incidences of stn, hilA and fimH in S. typhimurium isolates were 42.86, 71.43 and 57.14%, respectively. Only one isolate of 7 S. typhimurium isolates was positive for the three virulence genes evaluated, 3 isolates carried single gene and the other 3 isolates carried 2 genes. The distribution of stn, hilA and fimH in S. enteritidis isolates was found to be 40, 60 and 40%, respectively. 2 of the 3 genes were found in 2 isolates of S. enteritidis, while, the other 3 isolates were carried only one gene as shown in Table 5 and Fig. 2.

Table 5. Results of multiplex PCR for detection of virulence genes in the isolated S. typhimurium and S. enteritidis from the examined egg and egg-based products samples.

The isolated serotypes	Virulence genes
	Stn	HilA	FimH
1^st S. typhimurium	-	+	-
2^nd S. typhimurium	+	+	+
3^rd S. typhimurium	-	-	+
4^th S. typhimurium	-	+	+
5^th S. typhimurium	+	-	-
6^th S. typhimurium	+	+	-
7^th S. typhimurium	-	+	+
1^st S. enteritidis	+	+	-
2^nd S. enteritidis	-	-	+
3^rd S. enteritidis	-	+	-
4^th S. enteritidis	+	-	-
5^th S. enteritidis	-	+	+

Fig. 2. Agarose gel electrophoresis of multiplex PCR of stn (260 bp), hilA (497 bp) and fimH (1008 bp) virulent genes for characterization of both S. typhimurium and S. enteritidis.

Lane M: 100 bp ladder as molecular size DNA marker. Lane 1: Control positive for stn, hilA and fimH genes. Lane 2: Control negative. Lane 3: Positive S. typhimurium strain for hilA gene. Lane 4: Positive S. typhimurium strains for stn, hilA and fimH genes. Lane 5: Positive S. typhimurium strain for fimH gene. Lane 6: Positive S. typhimurium strains for hilA and fimH genes. Lane 7: Positive S. typhimurium strain for stn gene. Lane 8: Positive S. typhimurium strains for stn and hilA genes. Lane 9: Positive S. typhimurium strains for hilA and fimH genes. Lane 10: Positive S. enteritidis strains for stn and hilA genes. Lane 11: Positive S. enteritidis strain for fimH gene. Lane 12: Positive S. enteritidis strain for hilA gene. Lane 13: Positive S. enteritidis strain for stn gene. Lane 14: Positive S. enteritidis strain for hilA and fimH gene.

It was clear that gene pattern was not the same for all isolates, the variety in number and distribution of different virulence markers among screened Salmonella serovars suggests that within those serovars there are different pathotypes potentially responsible for different clinical syndromes in the host.

Therefore, to improve the quality of eggs and its based products and to safeguard the consumer from being infected with Salmonella all precautions showed be adopted during their handling and production.

References

Abd El Tawwab, A.A., Ammar, A.M., Ali, Aisha, R., El Hofy, Fatma, I., Ahmed, M.E., 2013. Detection of common (invA) gene in Salmonella isolated from poultry using polymerase chain reaction technique. Benha Vet. Med. J. 25, 70-77.

Adil, S., Muhammad, S.M., Iftikha, H., Faisal, S., Rao, Z.A., 2012. Prevalence of Salmonella species in hen eggs and egg storing–trays collected from poultry farms and marketing outlets of Faisalabad, Pakistan. Pakistan. J. Agri. Sci. 49, 565-568.

Adzitey, F., Rusul, G., Nurul H., 2012. Prevalence and antibiotic resistance of Salmonella serovars in ducks, duck rearing and processing environments in Penang, Malaysia. Food Res. Int. 45, 947–952.

Almario, J.A.N., 2014. Prevalence of Salmonella on laying hen farms and control of colonization in poultry through egg yolk antibodies. M.V.Sc. Thesis, Fac. Sci., Maryland Univ., USA.

Andrews, W.H., Hammack, T.S., 2001. Salmonella. In: Bacteriological Analytical Manual. 8th ed., Chapter 5. USFDA, White Oak, MD.

APHA (American Public Health Association), 1992. Standard Method for Examination of Dairy Products. 13thed. Washington DC., USA.

Arif, A.D., 2013. Isolation and identification of Salmonella species from the table eggs in Sulaimani province. AL-Qadisiya J. Vet. Med. Sci. 12, 24-27.

Can, H.Y., Elmali, M., Karagöz, A., Öner, S., 2014. Detection of Salmonella spp., S. enteritidis, S, typhi and S, typhimurium in cream cakes by polymerase chain reaction (PCR). Med. Weter 70, 689-692.

CIDRAP, 2006. Centre for Infectious Disease Research and Policy, Academic Health Centre, University of Minnesota. http://www.cidrap.umn.edu/cidrap/ contents/fs/food disease/causes/ salmoview.html

De Buck, J., Van Immerseel, F., Haesebrouck, F., 2004. Colonization of the chicken reproductive tract and egg contamination by Salmonella. J. Appl. Microbiol. 97, 233–245.

De Reu, K., Grijspeerdt, K., Messens, W., Heyndrickx, M., Uyttendaele, M., Debevere, J., Herman, L., 2006. Egg shell factors influencing egg shell penetration and whole egg contamination by different bacteria, including S. enteritidis. Int. J. Food Microbiol. 112, 253–260.

Dhillon, A.S., Maurer, A.J., Deibel, R.H., Haller, R.W., 1974. Feeding of different levels of Salmonellae to chickens. Indian J. Poult. Sci. 9, 103-107.

El Jakee, J., Khelfa, D.G., El-Safty, M.M., Seida, A.A., Marouf, S., Hahne, J., Mahmood, Z., Nagy, Sarah (2016. Multiplex PCR-based detection of S. typhimurium and S. enteritidis in specific pathogen free (SPF) and commercial eggs. Clin. Microbiol. 5, 241-245.

El-Kholy, A.M., Hassan, G.M., Mohammed, Dalia (2014. Microbiological quality of poultry farm table eggs in Beni-Suef City, Egypt. Assiut Vet. Med. J., 60, 10-13.

El-Prince, E.M., 1988. Microbiological quality of hen’s eggs. M.V.Sc. Thesis, Fac. Vet. Med., Assiut Univ., Egypt.

El Sherif, W.M.A., Hassan, A.M., 2013. The impact of temperatures to reduce the risk of S. arizona and S. enteritidis in table eggs. Assiut Vet. Med. J. 59, 146-154.

European Commission, 2003. Opinion of the Scientific Committee for Veterinary Measures relating to Public Health on Salmonellae in Foodstuff. Available at: http://europa.eu.int/comm /food/fs/sc/scv/out66_en.pdf.

European Food Safety Authority, 2014. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2012. EFSA J. 12, 35-47.

Ezzat, M.E., Shabana, I.I., Esawy, A.M., Elsotohy, M.E., 2014. Detection of virulence genes in Salmonella serovars isolated from broilers. Anim. and Vet. Sci. 2, 189-193.

Favier, G.L., Escudero, M.E., de Guzman, A.M.S., 2001. Effect of chlorine, sodium chloride, trisodium phosphate, and ultraviolet radiation on the reduction of Yersinia enterocolitica and mesophilic aerobic bacteria from egg shell surface. J. Food Prot. 64, 1621-1623.

Food Drug Administration, 2009. Prevention of S. enteritidis in shell eggs during production, storage and transportation. Final rule. Fed. Regist. 74, 33030–33101.

Galis, A.M., Marcq, C., Marlier, D., Portetelle, D., Van, I., Beckers, Y., Théwis, A., 2013. Control of Salmonella contamination of shell eggs preharvest and postharvest methods: A review. Compr. Rev. Food Sci. Food Saf. 12, 155–182.

Gantois, I., Eeckhaut, V., Pasmans, F., Haesebrouck, F., Ducatelle, R., Van Immerseel, F.A., 2008. Comparative study on the pathogenesis of egg contamination by different serotypes of Salmonella. Avian Pathol. 37, 399–406.

Gumus, T., Daglıoglu, O., Konyalı, A.M., 2005. Microbiological quality of cream cakes sold in Tekirdag province. J. Tekirdag Agric. Fac. 2, 215-220.

Guo, X., Chen, J., Beuchat, L., Brackett, R., 2000. PCR detection of S. enterica serotype montevideo in and on raw tomatoes using primers derived from hilA. Appl. Environ. Microbiol. 66, 5248-5252.

Harsha, H.T., Reshmi, R., Rinoy, V., Divya P.S., Mujeeb, R., Mohamed, H., 2011. Prevalence and antibiotic resistance of Salmonella from the eggs of commercial samples. J. Microbiol. Infect. Dis. 1, 93-100.

Hennessy, T.W., Cheng, L.H., Kassenborg, H., Ahuja, S.D., Mohle-Boetani, J., Marcus, R., 2004. Egg consumption is the principal risk factor for sporadic S. serotype heidelberg infections: a case-control study in Food Net sites. Clin. Infect. Dis. 38, 237–243.

Howard, Z.R., O’Bryan, C.A., Crandall, P.G., Ricke, S.C., 2012. S. enteritidis in shell eggs: Current issues and prospects for control. Food Res. Int. 45, 755–764.

Hussien, M.F., Sayed, M., Abdel-Azeem, M., Hassanein, R., 2009. Incidence of Salmonella species in table eggs sold in Assiut City. Zagazig Vet. J. 73, 131-140.

ISO 6579, 2002. Microbiology of food and animal feeding stuffs- horizontal method for the detection of Salmonella species. International Standard., 4th ed.

Kabir, S.M.L., 2009. The role of probiotics in the poultry industry. Int. J. Mol. Sci. 10, 3531-3546.

Karmi, M., 2013. Detection of virulence gene (inva) in Salmonella isolated from meat and poultry products. Int. J. Gen. 3, 7-12.

Kauffmann, G., 1974. Kauffmann white scheme. J. Acta. Path. Microbiol. Sci. 61, 385.

Korashy, E.A., Wahba, N.M., Hassanein, R., 2008. Public health hazards of some bacterial pathogens associated with consumption of eggs and studying the best cooking methods for their destruction. Assiut Vet. Med. J. 54, 59-75.

Little, C., Surman-Lee, S., Greenwood, M., 2007. Public health investigations of S. enteritidis in catering raw shell eggs, 2002–2004. Lett. Appl. Microbiol. 44, 595-601.

Maciorowski, K.G., Pillai, S.D., Jones, F.T., Ricke, S.C., 2005. Polymerase chain reaction detection of foodborne Salmonella spp. in animal feeds. Crit. Rev. Microbiol. 31, 45–53.

Makino, S., Kurazono, H., Chongsanguam, M., Hyashi, H., Cheun, H., Suzuki, S., Shirahata, T., 1999. Establishment of the PCR system specific to Salmonella species and its application for the inspection of food and fecal samples. J. Vet. Med. Sci. 61, 1245–1247.

Martinez, A., Navarrete, J., Corpus M., 2005. Identification of S. enteritidis in table eggs in Mexico City. Tecnica Pecuaria En Mexico. 43, 229-337.

Meldrum, R.J., Smith, R.M.M., Ellis, P., Garside, J., 2006. Microbiological quality of randomly selected ready-to-eat foods sampled between 2003 and 2005 in Wales, UK. Int. J. Food Microbiol. 108, 397-400.

Menghistu, H.T., Rathore, R., Dhama, K., Agarwal, R.K., 2011. Isolation, identification and polymerase chain reaction (PCR) detection of Salmonella species from field materials of poultry origin. Int. J. Microbiol. Res. 2, 135-142.

Min Chan, I., Jeong, S.J., Kwon, Y.K., Jeong, O.M., Kang, M.S., Lee, Y.J., 2015. Prevalence and characteristics of Salmonella spp. isolated from commercial layer farms in Korea. Poult. Sci. 94, 1691–1698.

Moats, W.A., 1980. Classification of bacteria from commerical egg washers and washed and unwashed eggs. J. Appl. Environ. Microbiol. 4, 710–714.

Molbak, K., Niemann, J., 2002. Risk factors for sporadic infection with S. enteritidis, Denmark, 1997 – 1999. Amer. J. Epidemiol. 156, 654–661.

Msallam, A.K., 2008. Occurrence of Salmonella spp. in hens eggs and their environment in selected farms in Gaza strip. M.V.Sc. Thesis, Fac. Science, Gaza Univ., Palestine.

Murakami, K., Noda, T., Onozuka, D., Sera1, N., 2013. Salmonella in liquid eggs and other foods in Fukuoka prefecture, Japan. Int. J. Microbiol., Vol 2013, Article ID 463095,1-5.

Murchie, L., Whyte, P., Xia, B., Horrigan, S., Kelly, L., Madden, R.H., 2007. Prevalence of Salmonella in grad A whole eggs in the island of Ireland. J. Food Prot. 70, 1238-1240.

Musgrove, M.T., Jones, D.R., Northcutt, J.K., Harrison, M.A., Cox, N.A. Ingram, K.D., Hinton, A.J., 2005. Recovery of Salmonella from commercial shell eggs by shell rinse and shell crush methodologies. Poult. Sci. 84, 1955-1958.

Nor Faiza, S., Saleha, A.A., Jalila, A., Fauziah, N., 2013. Occurrence of Campylobacter and Salmonella in ducks and duck eggs in Selangor, Malaysia. Tropical Biomedicine 30, 155–158.

Olsen, A.R., Hammack, T.S., 2000. Isolation of Salmonella spp. from the housefly, Musca domestica and the dump fly, Hydrotaea aenescens (Wiedemann) (Diptera: Muscidae), at caged-layer houses. J. Food Prot. 63, 958-960.

Osman, Kamelia, M., Amin, Zeinab, M.S., Bakry, M.A., El Safty, M. M., 2011. Identification of the Salmonella genes Yafd and Xtha: a step into the control of Salmonella food poisoning associated with consumption of eggs in Egypt. Global Veterinaria 7, 625-631.

Osman, K.M., Marouf, S.H., Mehana, O.A., Al-Atfeehy, N., 2014. S. enterica serotypes isolated from squabs reveal multidrug resistance and a distinct pathogenicity gene repertoire. Rev. Sci. Tech. Off. Int. Epiz. 33, 997-1006.

Plym, L.F., Wierup, M., 2006. Salmonella contamination: a significant challenge to the global marketing of animal food products. Rev. Sci. Tech. 25, 541–554.

Rall, V.L.M., Rall, R., Aragon, L.C., De Silva, M.G., 2005. Evaluation of three enrichment broth and five plating media for Salmonella detection in poultry. Brazillian J. Microbiol. 36, 147-150.

Rashwan, R.S., 2013. Detection of invA gene in non typhoidal Salmonella isolated from food products and clinical cases. M.V.Sc., Thesis, Fac. Med., Assuit Univ., Egypt.

Rezk, M.S., Saleh, O.A., 2008. Microbiological investigation of duck eggs with special reference to Salmonella in Bohira province. Assiut, Vet. Med. J. 54,118. 96-107.

Rodulfo, H., De Donato, M., Luiggi, J., Michelli, E., Millánand, A., Michelli, M., 2012. Molecular characterization of Salmonella strains in individuals with acute diarrhea syndrome in the state of Sucre, Venezuela. Revista da Sociedade Brasileira de Medicina Tropical 45, 329-333.

Sedeek, E.K., Aioub, K.H., 2014. First record for isolation and identification of S. enterica (serovar westpark) from eggs retailed at Alexandria Governorate. 2nd Conference of Scientific Association of Animal Health Research Institute, pp. 255-263.

Shanmugasamy, M., Velayutham, T., Rajeswar, J., 2011. InvA gene specific PCR for detection of Salmonella from broilers. Vet. World 4, 562-564.

Shirota, K., Katoh, H., Murasa, T., Ho, T., Otsuki, K., 2001. Monitoring of layer feed and eggs for Salmonella in eastern Japan 1993 and 1998. J. Food Prot. 64, 734-737.

Siriken, B., Cadirci, O., Inat, G., Pamuk, S., 2009. Microbiological examination of meatball, cream cake and turkish delight (lokum). J. Anim. Vet. Adv. 8, 2049-2054.

Solari, C.A., Mandarino, J.R., Panizzutti, M.H.M., Farias, R.H.G., 2003. A new serovar and a new serological variant belonging to S. enterica subspecies diarizonae. Memórias do Instituto Oswaldo Cruz. 98, 501-502.

Speck, M.L., 1984. Compendium Method for Microbiological Examination of Food. American Public Health Association, Washington, D.C.

Spitzer, H., 2016. An analysis of bacterial contamination of chicken eggs and antimicrobial resistance. College of Saint Benedict and Saint John’s University, all College Thesis Program. Paper 27. Available at http://digitalcommons.csbsju.edu/honors _thesis/27.

Suksangawong, C., 2008. Survey study on Salmonella spp. in eggs in Muang District. Chiang Mai. Proceedings, The15th Congress of FAVA, FAVA - OIE Joint Symposium on Emerging Diseases. Bangkok, Thailand.

Taha, Rihab; Alghalibi, S.M., AL-Ammari, Yasmin, N., 2010. Incidence and distribution of Salmonella serogroups in some local food in Sana’a- Yemen. Authorized by Al-Nasser University’s Research Office. www.al-edu.com.

Taha, Rihab; Alghalibi, S.M., Saeed, S.M.G., 2013. Salmonella spp. in patients suffering from enteric fever and food poisoning in Thamar City, Yemen. Eastern Mediterranean Health J. 19, 88-93.

Thammasuvimol, G., Seo, K.H., Song, K.Y., Holt, P.S., Brackett, R.E., 2006. Optimization of ferrioxamine E concentration as effective supplementation for selective isolation of S. enteritidis in egg white. J. Food Prot. 69, 634-638.

Tsegaye, S., Beyene, W., Tesfaye, B., Tessema, T.S., Feleke, A., 2016. Prevalence and antimicrobial susceptibility pattern of Salmonella species from exotic chicken eggs in Alage, Ziway and Shashemene, Ethiopia. African J. Basic and Appl. Sci. 8, 180-184.

Van Immerseel, F., 2010. Stress-induced survival strategies enable S. enteritidis to persistently colonize the chicken oviduct tissue and cope with antimicrobial factors in egg white: A hypothesis to explain a pandemic. Gut Pathogens 2, 23.

Wales, A., Davies, R., 2011. A critical review of S. typhimurium infection in laying hens. Avian Pathol. 40, 429–436.

Wilson, M.W., 2007. Survey of retail eggs for Salmonella. Client Report FW0779 Client Report FW0420 for the New Zealand Food Safety Authority. ESR Christchurch Science Centre, Christchurch, New Zealand.

Zansky, S., Wallace; Schoonmakerbopp, D., Smith, P., Ramsey, F., Painter, J., Gupta, A., Kalluri, P., Noviello, S., 2002. Outbreak of multidrug resistant S. newport. USA: JAMA. 288, 951-953.

Zubair, A.I., Al-Berfkani, M.I., Issa, A.R., 2017. Prevalence of Salmonella species from poultry eggs of local stores in Duhok. Int. J. Res. Med. Sci. 5, 2468-2471.